CcruzaQ_1832


Sequence

>CcruzaQ_1832 (2 EST) Length=507 TGCGCTTTTGCTTTGGCGCGTGCGAAACGCACAACTTTCCTGTGACGGTGAAGAACGTCTTTCAGTACAACCGCCCACTG AATTCCACTGAGATGACTGCAATCAAGGACAGGAAACCCAAAGATGAAAAAGGAAGCAGTGACGGTGAAGATAAAAAAGG AAGCAGAGACGGACTCCATGCATGGGGGCGTGTCGCGGGCGCTGCTTCCCGCTGATGCTGCTGGGGATGTGGGGCATTGC GGCCCTTTACTGAGAAATCGCAGTGAGGACTTCCTGCCACCAGCGGGAGCTATACGTGCCTCTCCACGCACCCTCCGAAA TAACTGACAATTTTTGTGTGGACGCAACTTTTATTTTATCTGTTTTTATGCTCGATTGGACTACCCCTTTCTGCCCGTGT AAGTCGTTATTTAAATGGTGTGCTCTTCCTCCGGGGACTGCACTGCGGGGCCTGTGTTTTTGTTTTTTTGCATATTTGTT TTTTCTTTTTTTATATGGAGGAATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_1832: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056713366328AI066163TENU2554T. cruzi epimastigote normalized cDNA Library
18058003366457AI066292TENU2408T. cruzi epimastigote normalized cDNA Library


Date: 5:13:57 on Sat 18 Nov 117.