CcruzaQ_1846


Sequence

>CcruzaQ_1846 (2 EST) Length=364 AAACGTAGTCCCCCGACTAACGCCTCAAACCAACAAGACACACACCCACCATAGGACAAACACATACGAAACAAGGACTG ACCACTGCAAGATGCCCGTGAGGTGGGGATGTTGCTGGTCCTTTCCCCAGACGCGTGCCACAAGATCCACCTGCAACAAA GAAAATATGGAGGCGTGCTCCAAGGCATCGCCAAACGCACAAAAAAAGGGAAGCTGCCTCACAAGTAGTTGTACTGCTTT GTGCCCTTTTCCTGCCGCTCCTGCCGCCTCAGTGGCGCCATGCGGATGTCCTGATCCGTCATGTACATCACTCGTTCCGG CACCGTCGCAGAAACAGCAAGGACCTCGCGCTTAACTAATGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1846: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057483366405AI066240TENU2356T. cruzi epimastigote normalized cDNA Library
18057773366434AI066269TENU2385T. cruzi epimastigote normalized cDNA Library


Date: 0:27:12 on Sat 25 Nov 117.