CcruzaQ_1904


Sequence

>CcruzaQ_1904 (2 EST) Length=341 CGCTGCTGATAGGGGCGTACGTGGGCACTTGATGGGTGTGGATGTTTAACTTTATGACGGCTGAATATGCGTGCAGGATT TCATCTGCTCATCGATGAGGCGTGCACGTAACACCGACTGGGACGAAAAAGTGTTGACGCATTTGGCTTGGTGTTTGGTT GCCACGTTTTTTTATTTTTCATTTTTGGCTAGCCGATATATTATTATTATTATTATTTTTGCTTATTTGTTTGTTTATTA ATTTTAACCGCTTTCATAATGTTCAGGGAAGTAATTCGAATGGGGTGAGTACAACTTTGACAACTGCCTATGGGAAGTGT AGCGTAAGGAACACAACTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1904: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656813244299AI026473TENU0685T. cruzi epimastigote normalized cDNA Library
17927613321097AI053218TENU1643T. cruzi epimastigote normalized cDNA Library


Date: 20:12:54 on Sat 18 Nov 117.