CcruzaQ_1905


Sequence

>CcruzaQ_1905 (2 EST) Length=333 GTGTCATGCAGGCGCTCATGAAAACACAAACGTAGGTGTAATTGCCGTAGTGACGCTGTTGTAGTTCGGCCTGAATAGGC GGTGCGGAAAAGCCTCCGACGACGCCGGCGAGAAAGACGGCGCCCATGTAAAAACCGAGATTTGGTCCATACAACCGCTC CGCAATAAGCGCTGGCATGACGGCAAACATCCCTGCCATGCAGAAACCAATCACGCAAAGAAGGAGGGCAAAGGCAACGT AACTGCGGCAAAAACCCAAAAAGGCACAAAAAATACCCCCAATTGTGGCGCATAAGACGTACGCAAACTCATTCGTGGTA CCTGTCGCAAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1905: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14786652804512AA756991TENU0054T.cruzi epimastigote normalized cDNA Library
16094662991615AA882504TENU0279T.cruzi epimastigote normalized cDNA Library


Date: 23:50:29 on Fri 17 Nov 117.