CcruzaQ_1946


Sequence

>CcruzaQ_1946 (2 EST) Length=329 GCAATGAACAGAGCATCTCGCAATCAACCTGGCAGTGAAAACAAATGCCTTTATCAGCCTCTCGGAGACTTCTTCGAGCA ACAGATCCGGAACGCTTAATATAAAAGGCCGCACGACACCGACCACTGCAAAACATGTCTGTATCCTTTTCAATGCACAC AACATCACCGGGCGATGGAGAAAATAGGGTTGGAAAAATGCCTTCGCACTCCAAGCAGAGCGGCACGTAGCCATTTCCCG AGATCCCCAGTTGTGCCGCGTATGGATGTGATGGGTACGGATGTCGCTGAACCTTCCAGAAAAATACTCTTCCCAGGACG GGTCGATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1946: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776772130860AA433383TEUF0258T.cruzi epimastigote non-normalized cDNA Library
17657473244365AI026539TENU0751T. cruzi epimastigote normalized cDNA Library


Date: 0:37:43 on Thu 23 Nov 117.