CcruzaQ_1953


Sequence

>CcruzaQ_1953 (2 EST) Length=592 AATATTCCCAGCAACGTGCCCTCTGACGCTGTCGACTACTCAAATCNTCTCGGGCGGTGTCGTAGCCGCTTCTCTCGTCG GAGCGGGACGCTGTCCTTGGGTGCACGCATCGCAGTGGAGTTCAGTGGGCGGCTGTACGGAAAGACGTCCGTCAGCGTCA CATGAGATTCGTGCCCATAGTATGATTGGACGCAGTGTGCGCCAGCATCGCAGTCAGTCGAGGAGTGCTCCCACTCGGAG TCTCTTCGATGGTCACCGACGCCACAAGTGTGGAGTCGTGGCTNAAAAACACATGACGCACTTTATCACCCCGAGTGTTC ACAGGCCCATATTGCCCTGGACTCAAGTCCCGTCACTTGTAACCTATCGTTGTCCTTCACTGCGTTCCTCCACCATCGCA TGCAGGCAACGGTACTCGTCGTTCCACGTGTCATCACTGGCCGCATCGGAAACAACTGCCACCAGACTCGCCGTGGGTTT AGACAAGCTGGAGAAGAAAATGTCCTTTTGCGCCCAAGTACTGAGGACGGAATTGATTGCACTCAGTTTCTCCGTCAGGC GGGAAAGTGAGATGACACCGCCCTCACCGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1953: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709742107918AA426681TEUF0261T.cruzi epimastigote non-normalized cDNA Library
12064802327559AA556107TENF0415T.cruzi epimastigote normalized cDNA Library


Date: 19:2:7 on Thu 23 Nov 117.