CcruzaQ_1966


Sequence

>CcruzaQ_1966 (2 EST) Length=326 AAACTGAAAAAATCAACGAATCAAGAAGGCGTGTGGGTACGTTTTGTCGGCAACTCTCGAATAGGTCCCCGTTGGCGTGC GGTCAACGCCTCGTCATCCACGACGCCCTCATAATTCACAGCCGCAGCCGCCTCATCGCCATCTACCGCCAGAGATGCAG GAAATAAATGAGCCGGTTCTGGTTGTAGTATCTTCAGCTCCTGCAAGCGTCCTTGATAGCCTCCGGTGCCCGCAGCAGAA ACCCCGGTATCATTTCTCGTAGTAACTGGTAAAGAGTGCGGGCGCGGTAAAAGTCACCGGCCACACGACAAGCTCTAAAA AGGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1966: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826563286578AI043321TENU0962T. cruzi epimastigote normalized cDNA Library
17826573286579AI043322TENU0963T. cruzi epimastigote normalized cDNA Library


Date: 2:42:1 on Mon 20 Nov 117.