CcruzaQ_2002


Sequence

>CcruzaQ_2002 (11 EST) Length=785 CGGGGTGGTTAAAANTAAAATTTTGCCCCCCCTTAAAATGGCTTTGTTTAAACCNAATNGGTTCCCTCCTTCTCTCCTCC CAAAACCCCTTCAAAAAAAACCCTTCTCCGACATCTAAAATTGTTTTTCCTTACTCTTCCTCCCTTCCTTCCTTTGGTCC AAAAAAAGCCAAATCCCTTCTCCCTCGGTTGCCTTTTTCCAAAATTCTCTCATTATGAAGACCAAAACGTTCCTCTCCCG TTCCTTCCCTCTCCTCCTCTAACTCTCCCCCCAAAAAAAACTTCCTCCAAAAATTCTTCTCCAAAAATCTGGCGGGTGTC CCCCAAAAATCCCCTTCCAAAAGCCTTTTTATACTAAAATATAATATTTAAAATTTATAAAGAAAAAAATGCCTGAAAAT AAAAATCTTAAACATCAANATCTCGGTCCCCTCATTTCACCCGAAAAGCCTTCTGCTCCCGTCCTCTCCATAAAAATGCT CCGCCCGTCGTCGGGAACTCCACCCAACTCCAAAAAATTCAAAATCCCAAAAAAACTTGGGGTGTTCCACAAGCTAGANT CCGGGTCCCTCCCTTCCTTTGGTCTAAACTGGGTTAAAAATCCTCTTCCCCCCAAAAACCCCCTTTGAAATTTAAAAATT CCTCTCGGCAAAAAATTCTCGTTCGAAAATCCGCTCCCATTCCTTCTCCTAAAATATATAATCAAATCCTTCGAACATCC CTCCTCCTTGCGGGCCCCCTTCTAAAATATCAAAAATCTCAAGCCGTCCCGTCGCTCCGGAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2002: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817492655827AA676163TEUF0044T.cruzi epimastigote non-normalized cDNA Library
13817502655828AA676164TEUF0045T.cruzi epimastigote non-normalized cDNA Library
13817542655832AA676168TEUF0066T.cruzi epimastigote non-normalized cDNA Library
13817592655837AA676173TEUF0083T.cruzi epimastigote non-normalized cDNA Library
13817602655838AA676174TEUF0084T.cruzi epimastigote non-normalized cDNA Library
13817612655839AA676175TEUF0089T.cruzi epimastigote non-normalized cDNA Library
13817702655848AA676184TEUF0146T.cruzi epimastigote non-normalized cDNA Library
13817782655856AA676192TEUF0185T.cruzi epimastigote non-normalized cDNA Library
13817812655859AA676195TEUF0201T.cruzi epimastigote non-normalized cDNA Library
13817842655862AA676198TEUF0233T.cruzi epimastigote non-normalized cDNA Library
16582283073747AA926611TENS1233T. cruzi epimastigote normalized cDNA Library


Date: 14:19:59 on Mon 20 Nov 117.