CcruzaQ_2010


Sequence

>CcruzaQ_2010 (2 EST) Length=337 GAAAATGTCTTCTTCGGCCGGAATGGCGTGTCGCGGGTGCGGAGGTCAAGAATGGGAACCTCCGTGTAGCCAAACTCCTC GGCGACCTTCGCAAGGTCAACACACCGCTCATTGTAGACATCCGAGGGGCCTATGAGGGAATAAAGCAACATGGTCGCAC GGTACGCAGCGTATGCGGCGTTTTGTACGGCAAATTGCTTCTTGTTCAGTGAGCGCATCTTCTGCAGTGACAACAGAAAA CGTGTGGCGGATGGAAGCTGCGGTAGCTGCTCAAAGGTTATATTTAGTCGCTTTGCGGGGCGCTGAAGGTAACTCAAGGC GGGCTGCAGTTCATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2010: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926433320979AI053352TENU1514T. cruzi epimastigote normalized cDNA Library
18047033340655AI065248TENU2135T. cruzi epimastigote normalized cDNA Library


Date: 17:8:16 on Fri 24 Nov 117.