CcruzaQ_2013


Sequence

>CcruzaQ_2013 (9 EST) Length=996 TGGCCTCGGANGCCACCNATTCGGCACGAGGCTCTGGGTACTGTGCTGTTTAAATGCCCCCAAATTTTTTCTCCTTTCCT GCTAGAGGCGCTGATGGTCCGCGACGAAGATTGTTTGCGGTCCCCATTGCNATGGCACGAGGGTGACTGGGTGCCGGCCT GCTGAGTGCACTCGGAGGGAGCGGATGGTGTGCGCCGTGCCTCACTGTGAGTGTGGGACGCCACCCGCCACNACCTGCTG TGAGGCGTAATGCCAATCCGTCGGGGCAGAGANAAGTAAAGGACTGCGNCGTGGTANTTGGATGCGNCTCGTCGCTCTTG TTGCGGCCGTGGGTGTGCTGTGCCCATGGCCCTTCGTTGCGGTGCGACGGGATTTTCCTACCCATGTCTTCACCCTTGTG AGTGGTGGAGTGAATGGAGAGAGGCTGTGTGTGCGTGTGTGTGCGAGGTGCCCCGTGTGAGTTGTGATTTCCTCCAATTG TAATTTAATTTGCCTCCGGCTTTTGTGGTGATGGGTCCTTTTGGGTTCTATTAAGTGTGTTTTGCGATTGGCGGCAAATG AAGTGTGTGGACGAGCAGAAGACTAGGAGCTTGTGAACGGAATGTTCGCGAGGAAGGCTGGCTGCCCAAATACATGTATA TCCTGATTGAAAGGATATATTTCTTTGGGAGTTTTTCCTATTTTATGAATCTTTTAGAAAACCCCGATGGTAGCAACCAG GGAACCGATAACTTCTGGATGAGTTTTAATTGCTTTTGTTTCTGCCGTCCCACCCGCCCCCTTTGTGGTTCTTACCTTGC GGCGGGGTCTTGCGGCTGGAGGAGCCCAAAGTCTTCCACTTTTTAGGTTGTGAATACATACAAACACGCACACNCACATA TATATATATATATATATATATATGACACCTGTTCAATTCCAGTGTTGGTATGCTTCTCTCGTTTAGGCAGTGCGAATGAT TGCGAGAAAAGGAGCAGTTAATTCAAAGTGCCCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2013: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064312327510AA556058TENF0253T.cruzi epimastigote normalized cDNA Library
13815542655632AA675968TENF0456T.cruzi epimastigote normalized cDNA Library
16098762992025AA882914TENS0491T. cruzi epimastigote normalized cDNA Library
16361573046198AA908126TENS0968T. cruzi epimastigote normalized cDNA Library
16943553123931AA958224TENS1507T. cruzi epimastigote normalized cDNA Library
17656793244297AI026471TENU0683T. cruzi epimastigote normalized cDNA Library
17972303331645AI057779TENU1870T. cruzi epimastigote normalized cDNA Library
18057063366363AI066198TENU2589T. cruzi epimastigote normalized cDNA Library
18319673411501AI077193TENU3415T. cruzi epimastigote normalized cDNA Library


Date: 7:29:46 on Sat 18 Nov 117.