CcruzaQ_2016


Sequence

>CcruzaQ_2016 (2 EST) Length=324 ATTCCTTCACCTTGAGGCCCTTCTCAAGGAGCTCCTCGGCCTTCTTGCCGCGGACGGTGCAGTGTACAGCAATCTTCTCG TTACGGCGGATGCCAAACGTCCGCACCGTCAGGCGGGCGCGAGAGAGTACCGGGGTCTGCTCGCACAGCTGCTCCAACAC CTTCGAGGCGCGAGTGAGACGATCGCCCGACTCGCCAACACAAATGTTGAGGCAGAGCTTCTTCACAACGATCTCCCGCA TCGGGTTGGTTGCTTTCTTCTCCGAAACGGCATGCGTCTCCATCGTCGATAATAAAGACGGCTTTTCCCTTGCTCCGGTC ACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_2016: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815702655648AA675984TENF0495T.cruzi epimastigote normalized cDNA Library
15941092963365AA867920TENS0027T. cruzi epimastigote normalized cDNA Library


Date: 5:59:14 on Thu 23 Nov 117.