CcruzaQ_2027


Sequence

>CcruzaQ_2027 (3 EST) Length=566 GTCCCAAAGCCTGGGACCGTCCTTGTGCATGCCGCGGGGGCAATGTCGTCGATACGAAGTTATAAGCGCTCTCGTGAAAG CCTTAATGCCGGTGGACAGCTTTTTATAGTCGTATGCCGGAAGTTGTGCGTCGAAGTCCTTGACGAATAAATCCCACTTG CACTTCCCCCAACTGTAGAAAAANTTAGGTGCCGAAGGGGGTGCCGAAGGTATGGTATCCTTAAACGCCTGATGCAGCGT AAATGTCAGCACATAATGATCACTAAGCGGCGACACAGAAGCTGACCAATCCGANACAGTCAGATGCTTTGACCATNTCA GATCGATACCAGGATCGTTCTCTTGTGCCACGGGCATACGTGATCTCACCAGGGGTGTTAACCAAGGTGAGTCCCGCATC CGTGCACAGTTCTTAAAATTCTGCGGCAACCTTGCTTGGAGAAGTCCCCAAGAATGGCTCCCACTGTGGGTGATNCATGT TGAAATCCCCGCACAGGAGGAGCGGCNACGAGGCTGGAAGNCAGTTTACTAACCGCCTGAAAAATTGCGTTACTTNCAGT GGTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2027: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709842107928AA426691TEUF0049T.cruzi epimastigote non-normalized cDNA Library
16095772991726AA882615TENS0186T. cruzi epimastigote normalized cDNA Library
18056123366269AI066379TENU2495T. cruzi epimastigote normalized cDNA Library


Date: 9:10:23 on Sat 18 Nov 117.