CcruzaQ_2034


Sequence

>CcruzaQ_2034 (2 EST) Length=420 CCGCTCAGTTGGNGCATCCTGTGCAGTGGATTGACCTTATGGATGCTGCCGTCATTCACGCAGGTATTCGCGAGGTACAC GAGATTTCACCTGTGCGAACGACCGCCGATATGTTTAGGCGTACAGCGTTTTGCGAGGCTGGTGAGGCGGGAGTTGCACC GGAGATGGTTATCCGCTGCCTTCCCGCAGAGGAGCGATTTTTGTAATAAAAAAAGAAGGGTTGGGAAATGGAGACGATTG CTGCTGCGGATTGCCCAGCTTTTTTTCCTTCTGAAGTTTGTTCCCGTTGGGATTGGCGCCCCATCCATGAATAATGCAAA CATATAAATTTTGTTTTGTTGGGAAGTCCGTTTGAAGAATTTTTCTCATTTTCACATTTTTATTATTTCCCTTTTTTTTT TTTTAGAGAATGGCTGCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_2034: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816702655748AA676084TENF0615T.cruzi epimastigote normalized cDNA Library
17854903293996AI046098TENU1184T. cruzi epimastigote normalized cDNA Library


Date: 10:29:28 on Mon 20 Nov 117.