CcruzaQ_2049


Sequence

>CcruzaQ_2049 (2 EST) Length=468 CCTCTTAGAGCCGGGCCCCCCTTTTTTTTTTTTTTTAAGAAAAAAAAAGAAAATTTAAAGGGCCCACCGCCAACAAAACA CCGCACCGAATATTCGCCTTGAGCTATTGGCCTTATATATTACGCTACAAAATAGGACGGGAAAAAAAGAGGGTAAATGG AAAGACAGTGACTCCGCCAACTTCCTCTCCGTTTGCTCCATATATATATATATTTATATATGTGTACATATTTCTTCCGG ATGGCCAACATCGTGGCCCGGTGCACTCTATTCGGGGTGGAGGCATATCGATCGCTTGCAAATTGCTCGAATTTGAGGTC CCCTCCAGCCCATCGGCGCTGCCCCGCCGCAAGGTGGAAATCAAATGAAGACTGAATGGGACAGTAAGAAATAAAAAAAA AAAAAAAAAGTTGCGGCCCCTCCCAGGTCNGATTGCCTCGTNTTCGAAANAGGAACCCTAAGAGGCNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2049: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776672130850AA433373TEUF0244T.cruzi epimastigote non-normalized cDNA Library
16189623017810AA890931TENS0781T. cruzi epimastigote normalized cDNA Library


Date: 20:3:47 on Sat 18 Nov 117.