CcruzaQ_2079


Sequence

>CcruzaQ_2079 (2 EST) Length=559 AAGAGAAAAAGAAACATATAAAAAGAAAAAACGTGAGATGTGGGATGCAAGCAGTCCGTGGCTGATCCCGGGAACACCCC GTGAGCGAAGACAAGAAGATTATTGAAAGACAAGGACGAGTTGTGCGAACGGTGTCGGAGCTGCTGTCTACAAAACTGGA TGGTCACGGCACGAACAACGCCGATGACAAGAAACCGCATGCGGCGGATAACGACAATACGATATAGAATGCTGCTGAAA GCGAAAATAATAAAAAAAATTAAAAAAAAAAAAAATGAAGGAAAAAAAAAACAAGAGAAAAAAAAAAAAATAGGGAAAAC CGCACCGAAAGGGGAATTTCTTATTGTTATACTCATTAAGGTCCTACACAATGAGGGGTTCCTGGTATTCGTCTAAACTC ACCACCACCACCATCATTCATCATTATCCTTTTTTTTTTTTTTCACGTCTTTTACTATTTATTTTGGCGTGTTTTCTCAG CGTGTGCACCCCTTTCCGTTCATTCTTTTTCTTCTTCTTTTGTTCTTGCACATCGGTGGGCGCTTGGTGTGCATTGGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_2079: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853813293887AI046254TENU1123T. cruzi epimastigote normalized cDNA Library
18690133492650AI110443TENU4046T. cruzi epimastigote normalized cDNA Library


Date: 23:5:29 on Mon 20 Nov 117.