CcruzaQ_2084


Sequence

>CcruzaQ_2084 (5 EST) Length=577 GTCCATTCACGATGTGTGCGGTTAGGTGTCATTTGGCTGGTGCGGCACGAGATAATGATGATGATTGTCGGGTTTGCATA AAATCATGACATTCTTATTTACCCCCTTTTTGTTTAGTTGTTTTAATTGGATATGCTTTATTATTATTATTGGGGGCGTG CGAAAAGAAAGTCCGCGAGAATACGGGCGACCTAATTTAATATGTTCTGATAAGACGAATATGTTTCTGTGCGGTCCTTT CCCATCTTAGGGTTCCTTGGAAGACCGCGATGGGAGGAGTCAAGGAACCGATGACGGCAGGATGAATTTTATTATTTTTG CCGTCCAACCCCCTTTTGACTCCAACCCTGCGGCGGGGTCTTGTGGTTGGAGGATCTTGAACTCAGCCACCTCGTAACTA ATAATATCTCCAGTCCGCAGAGGCTGCAGCACGTCACGGTGGCGGCCAGCCGAATATATATATAATTGGAGCGAACAACG AGGACGCGGCGAAGTCACTGTCTCTCCACCACCCCTTCCTTCCCATCCCATTTTGTTTTTATGGAAAAGTCTGGTGTCTG GTCAGCAGCCCGGGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_2084: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14534952772484AA738523TENU0032T.cruzi epimastigote normalized cDNA Library
17926353320971AI053344TENU1506T. cruzi epimastigote normalized cDNA Library
17927043321040AI053161TENU1581T. cruzi epimastigote normalized cDNA Library
17973093331724AI057858TENU1949T. cruzi epimastigote normalized cDNA Library
18415333421576AI083153TENU3830T. cruzi epimastigote normalized cDNA Library


Date: 21:16:30 on Sun 19 Nov 117.