CcruzaQ_209


Sequence

>CcruzaQ_209 (3 EST) Length=551 ATTCGCCACGCTTTCTGCAGCGCAGTGCGGAGCCCCAAGGAGATCCAAGAACAGCGGCGAAAGAAAGAAGCCCCCAGAAA TGCCAACACCTTGCTGTGGTTACTGGAACGCGCTTAGGCTGAACCAGGCCACCAGCTTGTCATCGCCATGAGGAAAGCAA CGTTGTCACCAAGGATGTAGAGGAAGTTGCCCAAGCACACGCAGAAACACAATCAACGCCGTCATCTCCATGCGGCCACC CTCTGCGCACTTCGCAAAAACGTGCGCATCTTAGGAATATCCCCCATCCATTTGGCCATGCGCATCAGGGAGCGACCGTC CGTGATGGAGCTGGAAACCGACTTGTATGCGGACCTGCGGCACTCAACGGCATCGAGGGCGGCAAGAGCCTTCAACACAC CGCCAACAAACTTGTAGATCTTGTCTCGACCGTCGGTCTGCCCAAGGAGCTTTACAAACTTGTCGAAGTCAGACATGATG CTATGTAGGGCTTTAAGCAGGAGAAAAAATTCCTTATAATTTTGTTGTTGTTGTTGTTATCGCGTTGCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_209: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786841542818D87302D87302Trypanosoma cruzi Y (Tomoo Tanaka)
17971553331570AI057704TENU1794T. cruzi epimastigote normalized cDNA Library
18336323415146AI078970TENU3591T. cruzi epimastigote normalized cDNA Library


Date: 2:39:42 on Fri 24 Nov 117.