CcruzaQ_2118


Sequence

>CcruzaQ_2118 (2 EST) Length=466 TCTGTGTGTGTGTGTGTGTTTTGTTCTTCTTCGGTCCCCATGGTGATACGGGGTGGTGAACTTCACTCCCACCACCACCA TCAACAAAAACACGTGTTTCTCTTGACTTTCATTAAAAGGATGTGAAGTGAATGCGGGAAACGAAAGAATGAGGGGGGAT AGTACGGGCGAGATGGGGGATGCATTATTCTTGAGGAGACAAAACAAAAGGGAAATTAGAAGAAGAAGAAGAAAAAAAAA AAAAAGGAAAAGATGTTCTGTGTGTCGGCATACATACACATGTATACAGATAGATATATATATATATTTATCTATTTATT TATATTTATGTGTGTGTGTGTTCTCCTCCCTGCATGCGGTTCCAGAAAATAAAGTAATGAAAATAAATACGCGTCTCTTT TCGTGCTGTGCTGTTCTGCTTTTTAATATTTATTCCGCTCTCTCTCTCTCTCTCGTTCTCCCTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2118: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826053286527AI043270TENU0910T. cruzi epimastigote normalized cDNA Library
18246053392843AI069868TENU2916T. cruzi epimastigote normalized cDNA Library


Date: 16:35:12 on Sat 18 Nov 117.