CcruzaQ_2137


Sequence

>CcruzaQ_2137 (2 EST) Length=312 CCCCCACTACTAAATGCCCATTGGATAAAATAAATGGGCGCCATGTTGTAATTAATTTGTAGGAAATGATTGTCGGAGCA GTACTCTCATATATATATATGTTTGTGTGTGTTTTTCCCAGAATGCGTCCGATTTTCAGCTGAGTACAGCCTTAGGGGCT TTGTTAACTTTTTCTTCCAGACCCAAGCAAATGCACTCATAAAAAATATTTACTCTGGATTAACTCAAAGCCCCCTCTTT TTAAAGACCCCAACTAAAAAAAAAGACACCAATACGGAGTGGGTATCATTGGTGTTATATATATGTTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2137: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656313244249AI026423TENU0634T. cruzi epimastigote normalized cDNA Library
17770983269271AI037797TENU0878T. cruzi epimastigote normalized cDNA Library


Date: 6:14:12 on Fri 24 Nov 117.