CcruzaQ_2144


Sequence

>CcruzaQ_2144 (2 EST) Length=307 GTCACTTTCCAGCAGCCCAATCACACCCGCTCCAGTCAAATCCGCCTGCTTCACCATTCTTGTGAGAGAATCCGTATTTG CGTTGTCAAGCGCAAAATGGACGGTCCATATCATGCCCGAAAAGAACGTCATTGNNAACGCGGCCTCCCAAACCTCCACT CTTTCTTTAGAGCTTAAAAGTGAGAGTAAAATTCTGTGTTTTTCCTCTGGAATATATTCGATCAATTTCGAGTTGTTGCT TTCCCCCTACATCACCGCCTATTTCAGGTACTTCAATTGGGTCCCATAGTGTTCCTCATGAAATTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2144: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13815712655649AA675985TENF0496T.cruzi epimastigote normalized cDNA Library
13815722655650AA675986TENF0497T.cruzi epimastigote normalized cDNA Library


Date: 6:32:41 on Thu 23 Nov 117.