CcruzaQ_2156


Sequence

>CcruzaQ_2156 (2 EST) Length=306 TCCTCTTTTTTCTTCGGATATCAATGATTGCTGTTTTTCTGTTATTATTATTTATTATTATTATTTTTATATTCTTTTTC CTGTTGTTGGTTGGTTGGTTGGTTTATTGTGGCGAAGTGTCGAGCGGCGGCAGCTCCCAACCCCAGAAGGAAAAAAAAAA AGTGATCAAAAGGAGGGAGTGGAGGAAACGGCGGTGTCGCAAGGGCGTGGGCCGCGTGTTTCTTCTTGCGGGTGCCACCG TCCATGTGGCGCTTCGTGACTGCGAATTTACGGTTGGCTCTGTGGATGGGCGTCGTGGTGGTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_2156: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16020242981511AA875681TENU0153T.cruzi epimastigote normalized cDNA Library
18046423340594AI065187TENU2067T. cruzi epimastigote normalized cDNA Library


Date: 4:13:49 on Mon 20 Nov 117.