CcruzaQ_2162


Sequence

>CcruzaQ_2162 (2 EST) Length=441 ATTTACCTTCAAAAGAAAAAAACAAAAGAAAATCGGGTTTTTTTTCTTCCGTTGACACAACCTCTCCTTTCCAACAAACG GCCACCCCGCGGCATCCGTTCCGTCACACTGCAAGCAACACCCTATGCCTTCTGGGAACGAGGTGCATTCCTGCCTTGCT GCTTACGAGCTACAGGCGCATCCCGGCCGTTGCTAGCATTACGAGCTTGAGGCGCATCCCTGCCTTGCTGCTTGCGAGCT TGAGGCGCATCCCTGCCTTGCTGCTTGCGAGCTTGAGGCTCGTTCCTGCCTTGCTGCCTACGAGCCTGAGGNGCATCCCT GCCACCACGCTGCATGCGACCACCCTTTTCCTTCCGGGTCGGCCGGGCGCCGTGCTGCTGCTGTGACCTTTGATTCAGCT GTGGCCTTTGCTTTTGCTGCTGTGACCCCTNGTGCCGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_2162: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16945903124166AA958209TENS1746T. cruzi epimastigote normalized cDNA Library
17656123244230AI026404TENU0615T. cruzi epimastigote normalized cDNA Library


Date: 6:9:21 on Thu 23 Nov 117.