CcruzaQ_2189


Sequence

>CcruzaQ_2189 (5 EST) Length=806 AACAGGTGGGCATTACGTTTAAAGCATTCTGATTTTCGGGGGCAGGAGGAGAACTAAATAGGCCAAAAAGAAGTTTGGGA GGATTATCCAGAGCATCGGTGGAGACATTCAATGCCATAGATGCAGTGGTNTGTGCAATACGGGAAACACTGTCGTAGCG TGGGNGACACGATATGTTTCTCCGTCTTGTCCGTGCAATTTTNTGCTCGGCATCGTGCTGTACGTCCTTGANTAGAGGGA ACGTGTGCTTGTCGCCAACGGATCGTTTTTTCCCCACCGAGCCACATCACGATGCAGTAAAACAGGCAAAAAGAGAGCCG CAGAACGATCAGTTCATTTTTTTTTTCTTACGTTATGGAGGCTGTGGGCCAAAAATGTGGAGGGCGGAGTAGTGTCAGTA TGTTTTACAATCGGGGATTTCACTCCCCTCTCCGTTTTTATTTTTTGTTGCTGCTGCTGCCGCTTCGTTTTGGTGGGGGT TGTGGCGGGTGAAGCAAAAGGCCTCGGGCAACGGTTTATTTCCTCAAAAATTCCCCAGACACATTTTTTGTGTGCGTATT GCTGGCGCGGGATGATTTATGCGAGGCCGCTGTTACTGAGAAGGCCACCTTTACAATTCCTTCTTTTTCCTGCCACGGCG GGCGACTGTGCGTCCCGGTGCGTCCTCACTGGCGTNGTTCCGTGGGGAATCCGCCACCACTGACTGGCTTTGTTTCGCCG CCACNGTGCCGTCATCCCGGCCTNGTTTGATCCGCTGTTGGGTGTTGCGGGTGTCTTTCTTTCCGGTGCGAGGCGCCCTC GTTCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2189: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6786891542829D87310D87310Trypanosoma cruzi Y (Tomoo Tanaka)
16097832991932AA882821TENS0396T. cruzi epimastigote normalized cDNA Library
16887403115510AA952414TENS1361T. cruzi epimastigote normalized cDNA Library
17442773215218AI005708TENU0340T.cruzi epimastigote normalized cDNA Library
17927543321090AI053211TENU1636T. cruzi epimastigote normalized cDNA Library


Date: 7:29:36 on Sat 18 Nov 117.