CcruzaQ_2191


Sequence

>CcruzaQ_2191 (2 EST) Length=321 TCGCTGCGGACTGTCCCAGGCGACGGGTACGACGCCACACAACGCGCAGAGAAGCGCACCGTCTGGTCGCTGAGAAAAGG CAGCGCGTGGGGCAGCGCGGGAGGCACAAAAAAACTGAAAAGGCTCGTCGCATCATGTTGGCAAACACTTCCCCTCGGTT CTCGGAGTTGTTTGCCTTCCAAATTCTCTCTCTCTCTCTTTTTTAAAAAATAGAACGCTGTTTCCTCCCGAGATATGTTG TGGAGGTGGCGCGGTACTCCCCAAACGGAGTTGTTTAATTACCGAACTTAAAACGGAGGGCGAGCGCGTTGAATAAAACG C


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2191: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17855843294090AI046192TENU1279T. cruzi epimastigote normalized cDNA Library
17926403320976AI053349TENU1511T. cruzi epimastigote normalized cDNA Library


Date: 5:47:5 on Sun 19 Nov 117.