CcruzaQ_2196


Sequence

>CcruzaQ_2196 (2 EST) Length=330 CGGTGGTTGTTTACACCGTTGCCGTGCGTAGAGGATTGGTTTTTCTTCGTATATGGCCTGAGCCGCGGAGTCGAGATGCG AGGCCATTTGTTTAGGGACCGCCCTCCGCGCCGAATGCACCTCCGGCGGGCCCGGCACAATGGGATTGCCGCAGCTGCGA TCGGGGAAATGACGTCGCCCTCCCGCGGAGAATGCCCGCGTGCGCCCCGGTTCGTCCGGGCGCAGGGAGAAAGGCGTGTT GGGGAGGCTGCGCTCGGCCAGGCTGTGATGGAGCGTCCGCCGGACACGAGGGCGGATGGAGTCGNGATCCATGGCCTCCA TGAAGAGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_2196: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189503017798AA890919TENS0769T. cruzi epimastigote normalized cDNA Library
17610163237423AI021810TENU0488T. cruzi epimastigote normalized cDNA Library


Date: 6:47:43 on Sat 25 Nov 117.