CcruzaQ_2211


Sequence

>CcruzaQ_2211 (2 EST) Length=303 TATANACGCANGAGGTTGGCCCTTTTTTTAAANTTTTTTTTAAATGCTTAATCATGTTAGCAACAACCGCGTAGCTGTGA AACACAAAATATGTTTTCCCTCATTGCTTCTTGTTCTTCTGTTGTTGTTGCTTTTTTTTTTTTTGCTCGTTCGTCCCTCT CGTTGCTGTTGGCTGAGCTTTTCGCGTTTTTTTTTTATGTTTGTCTTGGCCAGGTATTCGTGTTGCCCTCAGTCCCCATG CTTTTTCTCTTTTCCTCCCGCCTAGGACTTCCGCCTCCTGTTTCTTGGCGTCGGTGANCCCNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_2211: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581483073667AA926531TENS1153T. cruzi epimastigote normalized cDNA Library
17459353216876AI007366TENU0386T.cruzi epimastigote normalized cDNA Library


Date: 11:45:37 on Wed 22 Nov 117.