CcruzaQ_2258


Sequence

>CcruzaQ_2258 (2 EST) Length=301 GTCTCCAATAAAGTCCAGGGTGTAGCGCAGAACCTCCACGGTAAGTTTGTACTGCTCCTCATCGCGGCGGTCGTGACCCT TCAAAATGCGTTCAAAGTAGCCCCCATCAACAATAACAGCAACACGGCCGTCACGCTTCAAATTGCTTGATACAAACGCA GGCACAACTTCCGAAGGGGACGTGGAGGTTGGGTTCAACTGACACCGCTTTTCATGCTCGCCCTCGGGATCGTTCAAAGA CGCCTCTCCCGCTGAACTGCCATTTGCGTGTTCCTTTGACCAGAAAGGGCCCCTCGCAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2258: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16098232991972AA882861TENS0436T. cruzi epimastigote normalized cDNA Library
16098282991977AA882866TENS0441T. cruzi epimastigote normalized cDNA Library


Date: 2:27:46 on Thu 23 Nov 117.