CcruzaQ_2272


Sequence

>CcruzaQ_2272 (2 EST) Length=300 GGCTCGNAGGGCCAAATCGGAACGAGGAAAAAAAAAACACGCCAAAAATACGGTATGGCGGAATAAATGGCNTTTGTTGG AGTTGTTTTCCNCACTGCTGCCAACGTGACTCGTCTTGCCTGNAGCTCCATCCACCGTGCGGGGCATCACATGTGACACT ATTGGGATGCCGCAATGCGGAAAGCGGGGCANCAAATGTGGAGGAAATTTGTGACTTACTTGCCATCCCCGANACGGGGC GTCCGCNTGTCACAACGTGTGGTGAGGCGGTTTATTTGCCCAATATAAATGTTGTCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2272: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190403017888AA891009TENS0859T. cruzi epimastigote normalized cDNA Library
16887603115530AA952434TENS1372T. cruzi epimastigote normalized cDNA Library


Date: 22:45:27 on Thu 23 Nov 117.