CcruzaQ_231


Sequence

>CcruzaQ_231 (6 EST) Length=679 TGTGTGTGTGTGTGTTTCTTCATAGCGCTTCACATTGTTTAATTCTCTTCATTTTTCCCTCTTGCCCTACTCGTTTGGCC CGTGATCACACGTATTGCATACACACACGCACGGACCTTCCTCGTGTCTTCAAGCCAACACTTCCATAGAAAGCGGCACG AGGCTTTTTCTTTTCTTTTCTTTTTCTCTCTCTCCCCCCTGTTTTCGCCTGTTATGTCTCATTTATTCTTCTCTCCTTCC CCGTCACGCCGTGTAAAATAAAATTTTGGAGCAGCGCATGGCTCCACGGCCTACTCACCCTTAAGGGAAGCCAAAATGTT GTTTCGGATTGTGAGCATGTCACGTTTTTCGCCCTTTACATCGCCCTGCTTCAATCGTGCAATGCGGCCCAGTTCCATCT CCACGTACTCCGCGCCCAGCTGCAAAATCTTCTCCGCGATACGGGGGTACTGCACAGCTTCCACACCGGTGAGATCCGCC GCCGCCTTCTTCACCTTCTCGAGGCACTGCTTCTTCTCATCCACGCTCTTTTCCTTTAACATCATATCCCGCAGCACCTT TGAAAGCTCGTCGTTCACACCAACCTTCTCGGAAAGATCACCAGAAGGAAGACGATTCTTCCCGGTACGTTCATTGAAAT NATTCAACAAATTTTTCCAGGGTGGGGGCGCANGCTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_231: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860522153636AA441758TEUF0518T.cruzi epimastigote non-normalized cDNA Library
16580663073585AA926449TENS1071T. cruzi epimastigote normalized cDNA Library
17657743244392AI026566TENU0778T. cruzi epimastigote normalized cDNA Library
17854703293976AI046078TENU1164T. cruzi epimastigote normalized cDNA Library
18058263366483AI066318TENU2434T. cruzi epimastigote normalized cDNA Library
18302243404500AI075549TENU3126T. cruzi epimastigote normalized cDNA Library


Date: 0:33:47 on Fri 24 Nov 117.