CcruzaQ_232


Sequence

>CcruzaQ_232 (2 EST) Length=644 GAGACGGCCAGGTGGAGAACAAACGTTTTAGGGTTTGTTGTCCCGTATCCTTTNGGTGAACGAAAGAGCGACTCCGTTTC GGTCTCCCCTGGCANTATTATTCCTCCACCGGTACAAGATAAATGTCACAAGAAGAAGAACAAGGGCGGCGGCGATAAGA AACAACCTCTCGCGTGAATTAAATTGATGAAGCCAATTTAAATTGGCTGGCCGCCGACGATGTAATTTGTCGCGTTCTCC TCCGGATGCCAACCCAGCGAGTTGTGCGCCGGATGACTCGTTGGCTGATCTTTCCATCATAGACATCTCTTCACTCGACA TGCCTTCCATTTGAGAACTGTTCTTGTGGTGGTTCTCCATATTCCTCATGCACATGGAGCAATTCATGTGCTGCATTGCG CCCGACATGCCTGCCATTTGAGAGCTGTTCGTGTGGTGGTTCTCCATATTCCTCATGCACATGGAGCAATTCATGTGCTG CATTGCGCCCGACATGCCTGCCATTTGAGAGCTGTTCGTGTGGTGGTTCTCCATATTCCTCATGCACATGGAGCAATTCA TGTGCTGCATTGCACCCGACATGCCTGCCATTTGAGAACTGTTCTTGTGGTGGTTCTCCATATTCCTCATGCACATGGAG CAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_232: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817242655802AA676138TENF0691T.cruzi epimastigote normalized cDNA Library
16581733073692AA926556TENS1178T. cruzi epimastigote normalized cDNA Library


Date: 23:26:19 on Fri 17 Nov 117.