CcruzaQ_2335


Sequence

>CcruzaQ_2335 (2 EST) Length=296 AATTCGGCACNAGGGTTTCTGTACTATATTGTGGCCAACCACTGACTGCGGCGCACTCGTATGTGCATACTGAGTTTTGC ACAAAAAAATTATTTCCATTGTTTCTAGGAAAAGGTGTAGGCAAGCTGCTCCTGGAAACATGCTTCGTGGTATGACAGCC TTTCTGGAGGCCGTTGACAAACGGGCAGGGCAACTTGCGCGGCAGCAGGCGGTGGGGGAGGAAGCGACATCGCTGGAGGT GGAGATGGAAAAATCGGAAGAAAAANAAAAANGCAATGAGGGGAGATCNACAAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2335: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16887663115536AA952440TENS1378T. cruzi epimastigote normalized cDNA Library
18688043482811AI110391TENU3947T. cruzi epimastigote normalized cDNA Library


Date: 7:0:42 on Mon 20 Nov 117.