CcruzaQ_2353


Sequence

>CcruzaQ_2353 (3 EST) Length=434 CGGAGGTTCTGTACGATATTGCAAGCCATGAGTCAAGCAAGGTCGAGAGTTATCTTTTAAAAATACAGCAGGGAAGAAGA AGGCAAATGACGTACGAGGGAGCCATCGGCATCGATCTCGGCACAACTTACTCGTGCGTTGGTGTTTGGCAGAACGAGCG CGTGGAGATCATTGCGAACGATCAGGGCAACCGCACAACGCCGTCGTACGTGGCGTTCACCGACACGGAGCGTCTTGATC GGTAATGCCGCGAAAAACCAGGTTGCAATGAACCCAACGAACACCGTCAGCAACGCGAAGCATGGATTGGCCGTAAGTTT GAATGATCCCAATCTGCAGTCGGACATCAAGCACTGGCCCTTCAAGGTGACCGTAAAGGAAGGCAAGCCGGTGGTTCGGG TGGATTACCAGGNCGAGACAAAGACATTCTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2353: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709622107906AA426669TEUF0182T.cruzi epimastigote non-normalized cDNA Library
10709952107939AA426702TEUF0087T.cruzi epimastigote non-normalized cDNA Library
16095642991713AA882602TENS0173T. cruzi epimastigote normalized cDNA Library


Date: 22:52:51 on Wed 22 Nov 117.