CcruzaQ_2356


Sequence

>CcruzaQ_2356 (2 EST) Length=337 GGTGTTACCTTTGATGCATCAACCTTTTCAAAATTTTTCACTACCTCCAGTACACGAGTCAAGACATTGTCTTTGTTAAG AAGATACTGGCCAGTCCGGGTTGCTTCATCACCTCCTCCTTGGCCCTCAGTCTGAAACCGCGCCGATATGGCCAAAGGGA TTGAAATACTCGATAAATAATAATTATTCGATGCAGGTAAAATCTGGCGTTGTGCAGAAAAGATGCCAAGAGCACCAGCT CGACAGATAAATTTGCGTAAAAGCTGTGAGCGTTGCAGACTAATTTCCCTGGTTCCCCCTTTAAACGAAAAAAAAAAGNA TATAGCCTCGTGCTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2356: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097382991887AA882776TENS0351T. cruzi epimastigote normalized cDNA Library
16889723115742AA952646TENS1830T. cruzi epimastigote normalized cDNA Library


Date: 14:23:54 on Sat 18 Nov 117.