CcruzaQ_2358


Sequence

>CcruzaQ_2358 (2 EST) Length=453 GCANNAGGCACTGTTGAATTNGCCAAAGGAGTGCAAGCCGCCCATGGTGATTTCTTGGCCCGCCANAATGCGTTAGAGAA ACGGGAAGAANAACTTACCACACGTGTACAGAGGCTATTGCAGAAACAGAAANAGTTGTCGAAAGGCATTGTTCACTCNC AGGGCATCATTCGGGATGCGGTGTTGCATCAATGTGGGGTGGACGCCCTTTATGGAGCCAACGATGCTCTGGGGAAGACC CATAAGCTCTTAAACGAGCTGGAATCGCTTGCCACCGTTCGAGGCAAAGAGAAACGGAAGGCGGAAANGTTTTTATTGGT GTAGATGGAAGTGTGGAAAACGATCACAGACCGAGGTGTTTTTGGAGACCGCCTGCACGCACAGGCAGCAGCGGTGGCTT TNTCCCCACTCACCTACCTACTCCTTTTTTTATTACTGGNGCCCAAAAAANAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2358: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097942991943AA882832TENS0407T. cruzi epimastigote normalized cDNA Library
16098652992014AA882903TENS0480T. cruzi epimastigote normalized cDNA Library


Date: 2:51:32 on Sat 25 Nov 117.