CcruzaQ_2363


Sequence

>CcruzaQ_2363 (2 EST) Length=295 TGTTGTAAGCAATCAAGCACCCACGTTCACCCTTCAGTCAGAATAAAAAAAGGCGTACGACACAGGCTTGTGGTGCCGGA AAACGGTATGAACTAAGCCACTCTCCACGCTCACAGTGACGATAGAATTCATTTTTATATATTCGTTGAATACTGTGAAG TAAACGTCCCATTCACTTAAGACAAAATAAACAGGACTTTTTCTTCATTAATGTCAATTGCGTACTTCAATCTGAAAATC CAAACGACGCAAAAGATAAAAATAAAATAAAATTACACAGGAAACACACACACAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_2363: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512732767058AA736301TENU0010T.cruzi epimastigote normalized cDNA Library
17825913286513AI043256TENU0896T. cruzi epimastigote normalized cDNA Library


Date: 9:36:2 on Fri 24 Nov 117.