CcruzaQ_2364


Sequence

>CcruzaQ_2364 (2 EST) Length=335 TTGGGGGGGATATTGGCCTCTGAGGCTCCATTATTCGGCACGAGGATTANTTCATGGATGCNATGTATTCTCTCATAAAG GATCCAGAAAACACCAATGCAAAGGAAGAATTTGATTGGGCAGCAGCTGAGCTTGACAAATTATTGGCGGAACATCAGTT TGGGGAGGGTCCATTTTTTGGTGGAGCCACAATGAATGCTGCTGACGTTCTCTTTGCCCATGCTGGTGCACCTGAAGGCC TGCACTCCAGATCTGACGGAAGGCCAGGATTGCTGCAATTAGACGTGTGGCCGCCGCCGCGGAAGCGCTTGACGAGTGAA GCAGGCAAAGCTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2364: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095882991737AA882626TENS0197T. cruzi epimastigote normalized cDNA Library
16097672991916AA882805TENS0380T. cruzi epimastigote normalized cDNA Library


Date: 5:0:44 on Sat 18 Nov 117.