CcruzaQ_2375


Sequence

>CcruzaQ_2375 (2 EST) Length=369 TGCAGGTGGAAAAGGGCCTTTCCGCAGGGCGTTTTGCGTGGCAGCCATCTGGCCCACACTTCGCCGTCATCTTTGAGGAT CGCACGAAGGTGAGTGAGTTGGGATCGACGTCTGAGATCCGTATTTACAATATTAAAAACGAGCTGAAGCTGCTGGGGCG TTTTATGACGAGTGCGACGCACCTCTTCTGGGCCCCACGTGGTGCCCGCGTAGTTGCCACAAACTACAGCAAGTCGATTA TGCACTTTTACGGCATCAACGACCAGGGTATGGTGGTTCAACTGGAAAAGCACGCTCTTCCTGTGACAGACACGGCATGG GACCCGACGGGCCGCTTTTACGCTTCTTGGGTATCGGCGCTGAAGAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_2375: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17853983293904AI046271TENU1141T. cruzi epimastigote normalized cDNA Library
17928143321150AI053271TENU1700T. cruzi epimastigote normalized cDNA Library


Date: 16:48:14 on Wed 22 Nov 117.