CcruzaQ_2478


Sequence

>CcruzaQ_2478 (2 EST) Length=292 AGGGGGAAAAACGACGAAGAAAAGGCTTTAGGAAGAAAATTGTTTTCGTTTTTTTTTCTTCTTTTTTTTCCTGTGCGTTC ACAATACCAGAAGAAAAGAGAACATGGTAGCGGTTCGTGCAAAGGTCGGTTCCCGCGGCTTCGTCCGCCAGAAGCAACTG GCGAAGGGAAAGAAGGTGTTCAAGATTGACTGCACCATTCCCGCCAATGACGGCATCTTCAGCGAGGAGATTCTCGGCAA CTTTGAGCAGTACTTCCAGGAAAATGTGAAGTTGAACGGCCGCAAGGGGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2478: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16890403115810AA952714TENS1898T. cruzi epimastigote normalized cDNA Library
17971333331548AI057682TENU1772T. cruzi epimastigote normalized cDNA Library


Date: 12:24:58 on Fri 17 Nov 117.