CcruzaQ_2524


Sequence

>CcruzaQ_2524 (2 EST) Length=359 AGGGCGGGCGACGAGTNCTTTACCGCCCACATGGCGAGGAATACGTTGACACAACTTAAATCTGAACACAAGGAAAAAAC TTCGCGAAAAACTGGTGCCCAAGACACTCCGCGACAAGAATAAGAAGACGGAGCGAGCGTTACCAGCAGCCTGGTATTTT CCGCAAATGCGCTACTTTGAATCGTTTGTGGAGATGCTGAGAAGCGTGGCTCCGACGCAGAAGGCCCTTTTCACAGCCGT CTCGCGGGTTCTTGCGGTCAACCGGATAGTTTCAGGCGATTTGTGGGAAAATCTGTCGAAAAAATTTGACGCCCTCACAG AGGAGGAGCGGGCGAAGTTTAGGCCTATCACGGATGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2524: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188063017654AA890775TENS0622T. cruzi epimastigote normalized cDNA Library
17971823331597AI057731TENU1821T. cruzi epimastigote normalized cDNA Library


Date: 21:3:4 on Sun 19 Nov 117.