CcruzaQ_2540


Sequence

>CcruzaQ_2540 (2 EST) Length=389 AGCGGATTTTTTGCGGTTAGTTACACAGTTCGAGCCCGAAAAGAAGAGGAGGAACCACTTTTTCGCTCTCGTTTGCTTAG CCTCCTAACGAATAGCACTTATCGGTATTTTCCAGATGTCACAGTCATGAGTCGCATCTGCCGACTGTTGCATTTTAGTG GCTTGTGCTACGTGACGTTGCACTGGGGTGGAACCGCGTTGGCAAGATGGTTTGAAAACTCGATGCTGCGTACTGGGCAG CCGGAGCACCAGCAGTTACTGCGTGAATTTACAGAAGCGGTACAAATCGTGCGTGATGAGATTGAAGCCTCCTAAATGGC AAGAAAGAGGCAGAGATAAATGAAGGGTAAAAGGGAAACGGATTATCTTGCGCAATGCCACCACGCGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2540: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17826583286580AI043323TENU0964T. cruzi epimastigote normalized cDNA Library
17895643299231AI050114TENU1356T. cruzi epimastigote normalized cDNA Library


Date: 6:8:59 on Thu 23 Nov 117.