CcruzaQ_2542


Sequence

>CcruzaQ_2542 (2 EST) Length=289 AAAAAAGAATAACAATAAAAACTTTTTTGCTTCGCGCTTCTCTTTCATGCATCAGTGTGGATTTGCTTTCCTCTCCTCTT GGCCTGCGTGGCGTTTCTGTCGGCCCATGGAGGGCAGCGAGAACCAACGCAGCCCCGCACATCCCCCCTCTTGACGCAAG GCAATCACTATCCGCGGCGACAACAACAAGAGAAAAACGCCCAAAGAAGTGTCAAGAAAAGGGAATAAACCAAAAGACTG AAAAAAACAACAACAAAAATATGAATCACGGGTCACCCCCCAACGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_2542: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17657563244374AI026548TENU0760T. cruzi epimastigote normalized cDNA Library
17896153299282AI050165TENU1410T. cruzi epimastigote normalized cDNA Library


Date: 9:28:23 on Sun 19 Nov 117.