CcruzaQ_2554


Sequence

>CcruzaQ_2554 (2 EST) Length=289 TGGAACGAGGGTTTCTGTACTATATTGGTAAAAATATGCATTGATTGTACCACAGTTTGTTTTCTATTTTGTTTATTTGA ATGTGTGTGTGTGTGTCTCTCTGTTTCTGCAGGAAGTCCCCGGTAGGCCGTTTAGGAGGAACGACCAATTGTGAGACGCA TGCGCCACGTCGTTGCCCGTTTTTTGTGCAAAATCACGGGAAGAAAGCCACCCTCTGACTTTGACACTCGATAAAGTGGT CTTCTCTCAGCCTGATAGGAATGGGTAATATCTTTCATGTTTGGTGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_2554: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095392991688AA882577TENS0148T. cruzi epimastigote normalized cDNA Library
16095412991690AA882579TENS0150T. cruzi epimastigote normalized cDNA Library


Date: 23:36:47 on Fri 17 Nov 117.