CcruzaQ_2576


Sequence

>CcruzaQ_2576 (2 EST) Length=425 TTTGGCCTCNGAGGGCCCTATTCGNCACNAGGCCATTATCCTGTTACTTATTCTTTTGCCGCTCCTCTGCACTGTGGGAC CGTGTGCCAAAACGTGCCTGTGTAAGCAGAGCCTACTGCAACATACCATAGTTGTGCTCTACGAGAGCGGTATCGGCAAA GTTGTTGCTGTGAGCGATTCGCACATAATGATGATTACTTATTGTTTCTGAAGTTAGCCCTTCAGTCCGATGCATTCATG ACGATTGAACACCGTTCATTGCTGTGACTGATGCGCCTTTTACTCCTCTCCATTATCCTGTTACTTATTCTTTTGCCGCT CCTCTGCACTGTGGGACCGTGTGCCAAAACGTGCCTGTGTAAGCAGAGCCTACTGCAAATGATGTTAATTGCATGCTTTT GTTTGTTGGATTCATCGGTTTTAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2576: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16187983017646AA890767TENS0614T. cruzi epimastigote normalized cDNA Library
16889793115749AA952653TENS1837T. cruzi epimastigote normalized cDNA Library


Date: 14:29:13 on Fri 17 Nov 117.