CcruzaQ_2622


Sequence

>CcruzaQ_2622 (2 EST) Length=287 GAGGNCCNAATTCGGCACGAGGAGCCCGGGAGCCACGACGGGACTTCTGCAGCTATCAGCTACAGCGGATAGTTGGAACC ACAATCGCAGGGGTGAGAGCGTTCACGTGGAANATGAACATAACACGTCGAAGGCGTCCTTCAATAAGCTCTTGACTGCC ACACCCACCGTCCACTGTAATCCACAGACACAANTGGGGCATGAACATTCAACTGCCTTCTTTTCTCTTCATCCCTTGTC GAAAAACGTCATGCAGGAATGGAACGACGGCCGTGACGATGAGAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2622: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16888143115584AA952488TENS1426T. cruzi epimastigote normalized cDNA Library
16943823123958AA958251TENS1534T. cruzi epimastigote normalized cDNA Library


Date: 2:0:53 on Sat 18 Nov 117.