CcruzaQ_2656


Sequence

>CcruzaQ_2656 (2 EST) Length=412 GTGTCGCTAGCGGGGTATCAGGTGGAACTGAAATGCTGCGACGGTGGTCGAATTGCGCTGCTGTCTTCTTAGCGGCTACG GCTGTGCACACCACGCAGCGCGAGATGCACGGAAAGCCGACACACTCGCACAAAGTCCGCAACCAACACGAGGGCCGACG GTGGTGGACACAGTCGAAGGCCCGTCACCTCACAGCAATGCCACACGATGAGTGTAAGTCCCGTCCACACTTCCCTGCCT ATAACGAGGATGTAGATCGCCCCATGTTGGTACCGGCCGGTGCAACTTGCTTCAATTGCGANAAGCCTATTGATGATAGG GACGTCAACAGCTACNTCTGGATCCCAGCTGGAAATGCCACGGTCCCAACGACGCAGGGGTACTTCTTTCACTTCAAATG CTTCAAGTGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_2656: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189433017791AA890912TENS0762T. cruzi epimastigote normalized cDNA Library
18242933392531AI069556TENU2590T. cruzi epimastigote normalized cDNA Library


Date: 1:11:41 on Tue 21 Nov 117.