CcruzaQ_2678


Sequence

>CcruzaQ_2678 (2 EST) Length=333 GACCAATCTTGGAGCTTGTGTCAATGAACTTCAGCGTGATCTGTTCCGTGAGCTTGCGCGATGTCTGTGGGGCCATGGGA CGACGCAGTGTGATGACGCGACGGCGAGGACCCGCAACGGAGCCCTTCAGCATGATGTAGTCGTTGCGCACTGTACCGTA GCCAACAAAGCCACCCATCGGAGTGATGGACTTGGCTGTGAGGTCGTACGTGGTCGTGGCCTGGTTCGGCTCCATCGACA CCGCGCGGCCCAGCTGGTAGATCTTCTTGTTGAGGTGTTCAAACTTGGTGNCGAGACATTNGAGNNTNTGTGCAAGGGAA GNNAGCCTCCGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2678: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944843124060AA958103TENS1636T. cruzi epimastigote normalized cDNA Library
18688373482844AI110308TENU3980T. cruzi epimastigote normalized cDNA Library


Date: 18:56:33 on Thu 23 Nov 117.