CcruzaQ_2684


Sequence

>CcruzaQ_2684 (2 EST) Length=323 CGGCCCGAGGGTTTCTGTCCTATATTGAAAGAGAGAAAGAGGATCCAATCGAACACTGCAAGCATGGGCAAGATCCGCAC GAAAACGGTGAAGCGCGCGTCGAAGCAGCTGGTGGAGAAGTATTTCTCGAAGCTGAACAAGGACTTCTACCAGAACAAAC GCGTTGTCATGGACGTCACCATCGCCCGCTCCAAAAAGCTGAAGAACAAGATTGCCGGGTATACGAACACACATCATGAA GCGCCTGGCCCGCGGCCCCGTCCGTGGCATCTCGCTGAAGCTGCAGAGAGACGCAACGCGCATGAATACTNCCGAGTTTC CAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_2684: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12063942327473AA556021TENF0135T.cruzi epimastigote normalized cDNA Library
15941002963356AA867911TENS0018T. cruzi epimastigote normalized cDNA Library


Date: 16:22:17 on Fri 17 Nov 117.