CcruzaQ_2688


Sequence

>CcruzaQ_2688 (2 EST) Length=293 TCTCTCTGTTGGTGAATCATGCAAAGAATTCCCCCTCCACTTTCCACGGCAAGGGATTATCGACAACGCGCCCCGCTCCA AAAAGAAAAAAAAAAAAGGAGAATTCTAAGTGTTGCTTTTCAAGACACCAAAAAGGTTAGGCGGCATCTGTAGCTGCTCG CTCCAATGACCACCACATTGCCATAATCCATTCCTGTAGCGAAGATTCGTGTTGATCTCGATGATGATGGCACGTGTGGA CCTCCACCGCCCTGGCGGCGCGGACCACGGGGGTGTGACGGAAATCTCATGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_2688: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14512722767057AA736300TENU0009T.cruzi epimastigote normalized cDNA Library
18056233366280AI066390TENU2506T. cruzi epimastigote normalized cDNA Library


Date: 16:9:40 on Sat 18 Nov 117.