CcruzaQ_269


Sequence

>CcruzaQ_269 (2 EST) Length=542 ANTTTGCCTCNGAGGCGCCAATCGGCANNAGGCGTCGATGAGGCACAGGCACGTCCTGATCCAACCAAANAGGCAAACAG CGAGGCTTTGCCAAATCCCTGGGAAAGGCAATCGTCCANTTTGCAGGGCGCATCAGGGTTAAACTCAATGAATGGAAACA CAAATAATTTGTTTAGTGCATTTGGCGGACTTGGAGCTTNTGGAGGTTCGATGCCTTTTGCTGGGCTACCCGGTAATATT GCATCATTGGGTCACACGAATCCCGTGACCGCGGCTTCCTTTTTGCCTCCACGGATGCTGCCTTCTNCTCATGAANGAAA CCATGTGCCAACTACGGATCCTACCCACACNANGGAGCATCAGCAAATACTGGAGANTGGGCGTCACANTTAGCAACATT AAGGGANATGGGATTTGATNATGACGCACTGTGTTTATAACCTTGCGTGCGTCAAATGGAAATATTNATGGGGGCTGTTA ACTACATNGCTNATTAAGATAAATNACCTTGGATCCTCCCCCNGGCACAAAGAATTATGANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_269: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16360783046119AA908047TENS0887T. cruzi epimastigote normalized cDNA Library
16944903124066AA958109TENS1642T. cruzi epimastigote normalized cDNA Library


Date: 6:54:42 on Mon 20 Nov 117.