CcruzaQ_2718


Sequence

>CcruzaQ_2718 (2 EST) Length=403 AAAAAAAGGNAACACATATAAAGTACGAGCCGTCCCCGCAAGGAAATGCANGANTAATCCCAATCACCGCACAGCAGCGC AGATAAGGGCGGTGACGAGCAGCAGAGACATGCGCACCCACACAGTGGCGGCGTCGCTGCTGTCCGCACCGCCGGGATCC CGCATCCCAGTGGCGGTGCCTCCAGATGGAGAAGAGGGCGTCTGACTGGAATTTTCGGGTGCTCGATGCCANGTGTTCGC CTCGTGCCTGTGGATGTAATGGCAGACTGACGGCGAAAAATTCGCCTAGANTTGGATAAGAGCCGCCTTNGTCTGTGTGC TCAGGCGANTTTTTTTGCGGCGCCTCAGCTGCCTCCCCCGGCGGACTGCCGACNCCGCTCTGTGCCTGCCTNGNGCCGAT TAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_2718: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189103017758AA890879TENS0729T. cruzi epimastigote normalized cDNA Library
16889643115734AA952638TENS1822T. cruzi epimastigote normalized cDNA Library


Date: 23:2:23 on Wed 22 Nov 117.